scramble sirna Search Results


96
Addgene inc plko 1 scramble shrna
Plko 1 Scramble Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+sirna/bio_rxiv__64898__2026__01__20__700661-146-1-4?v=Addgene+inc
Average 96 stars, based on 1 article reviews
plko 1 scramble shrna - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

95
OriGene control scrambled shrna
Fig. 3. P2Y1 silencing impairs ADP-dependent axon elongation. (A) Hippocampal neurons were nucleofected with scrambled <t>shRNA,</t> P2Y1 shRNA or P2Y13 shRNA. Neurons were fixed at 3 DIV and stained with an anti-a-tubulin antibody. Nucleofected neurons were identified by their GFP fluorescence. (B) HEK- 293T cells were co-transfected with GFP, P2Y1–GFP or P2Y13 plasmids, in combination with different P2Y1 or <t>P2Y13</t> <t>shRNAs.</t> Data are means ± s.e.m. of three independent experiments. P2Y1–GFP and P2Y13 protein expression was normalized to a-tubulin expression levels; ***P,0.001. (C) Axon length of hippocampal neurons expressing scrambled shRNA, two different P2Y1 shRNAs or two different P2Y13 shRNAs was quantified after staining with antibodies against MAP2 and Tau-1. Data are mean axon lengths ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. The dotted grey line indicates the mean axon length of scrambled-shRNA-nucleofected neurons. (D,E) Hippocampal neurons nucleofected with scrambled shRNA or P2Y1 shRNA and treated with ADP (5 mM) from day 1 to day 3 in vitro. The graph in D shows the axon length in nucleofected neurons (GFP-positive) incubated in the presence or absence of ADP. (F–H) Hippocampal neurons nucleofected with scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA and treated with the P2Y1 antagonist (MRS-2179) or the P2Y13 antagonist (MRS-2211) from day 1 to day 3 in vitro. Scale bars: 50 mm. Note that in all cases P2Y1 expression and function is necessary for axon elongation. Data in G are the mean axon lengths ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. H shows the distribution of the axon length for all neurons from three independent experiments for each condition (n5300). (I) Hippocampal neurons that had been nucleofected with plasmids expressing GFP, P2Y1–GFP and P2Y13. After 3 DIV neurons were stained for MAP2 and Tau-1 to identify the axon. (J) P2Y1 or P2Y13 mean fluorescence intensity along the axon in control, scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA nucleofected neurons. (K) Graph of the mean axon lengths ± s.e.m. of neurons nucleofected with GFP, P2Y1–GFP or P2Y13 and GFP. Neurons were quantified in three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. Scale bars: 100 mm. Box-plot shows the distribution of axon lengths for all the neurons quantified in K.
Control Scrambled Shrna, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+sirna/pm22250198-272-10-16?v=OriGene
Average 95 stars, based on 1 article reviews
control scrambled shrna - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

95
OriGene pgfp v rs ca v 1 2 shrna
Fig. 3. P2Y1 silencing impairs ADP-dependent axon elongation. (A) Hippocampal neurons were nucleofected with scrambled <t>shRNA,</t> P2Y1 shRNA or P2Y13 shRNA. Neurons were fixed at 3 DIV and stained with an anti-a-tubulin antibody. Nucleofected neurons were identified by their GFP fluorescence. (B) HEK- 293T cells were co-transfected with GFP, P2Y1–GFP or P2Y13 plasmids, in combination with different P2Y1 or <t>P2Y13</t> <t>shRNAs.</t> Data are means ± s.e.m. of three independent experiments. P2Y1–GFP and P2Y13 protein expression was normalized to a-tubulin expression levels; ***P,0.001. (C) Axon length of hippocampal neurons expressing scrambled shRNA, two different P2Y1 shRNAs or two different P2Y13 shRNAs was quantified after staining with antibodies against MAP2 and Tau-1. Data are mean axon lengths ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. The dotted grey line indicates the mean axon length of scrambled-shRNA-nucleofected neurons. (D,E) Hippocampal neurons nucleofected with scrambled shRNA or P2Y1 shRNA and treated with ADP (5 mM) from day 1 to day 3 in vitro. The graph in D shows the axon length in nucleofected neurons (GFP-positive) incubated in the presence or absence of ADP. (F–H) Hippocampal neurons nucleofected with scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA and treated with the P2Y1 antagonist (MRS-2179) or the P2Y13 antagonist (MRS-2211) from day 1 to day 3 in vitro. Scale bars: 50 mm. Note that in all cases P2Y1 expression and function is necessary for axon elongation. Data in G are the mean axon lengths ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. H shows the distribution of the axon length for all neurons from three independent experiments for each condition (n5300). (I) Hippocampal neurons that had been nucleofected with plasmids expressing GFP, P2Y1–GFP and P2Y13. After 3 DIV neurons were stained for MAP2 and Tau-1 to identify the axon. (J) P2Y1 or P2Y13 mean fluorescence intensity along the axon in control, scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA nucleofected neurons. (K) Graph of the mean axon lengths ± s.e.m. of neurons nucleofected with GFP, P2Y1–GFP or P2Y13 and GFP. Neurons were quantified in three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. Scale bars: 100 mm. Box-plot shows the distribution of axon lengths for all the neurons quantified in K.
Pgfp V Rs Ca V 1 2 Shrna, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+sirna/bio_rxiv__64898__2025__12__11__693636-221-0-9?v=OriGene
Average 95 stars, based on 1 article reviews
pgfp v rs ca v 1 2 shrna - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

96
OriGene shrna
Fig. 3. P2Y1 silencing impairs ADP-dependent axon elongation. (A) Hippocampal neurons were nucleofected with scrambled <t>shRNA,</t> P2Y1 shRNA or P2Y13 shRNA. Neurons were fixed at 3 DIV and stained with an anti-a-tubulin antibody. Nucleofected neurons were identified by their GFP fluorescence. (B) HEK- 293T cells were co-transfected with GFP, P2Y1–GFP or P2Y13 plasmids, in combination with different P2Y1 or <t>P2Y13</t> <t>shRNAs.</t> Data are means ± s.e.m. of three independent experiments. P2Y1–GFP and P2Y13 protein expression was normalized to a-tubulin expression levels; ***P,0.001. (C) Axon length of hippocampal neurons expressing scrambled shRNA, two different P2Y1 shRNAs or two different P2Y13 shRNAs was quantified after staining with antibodies against MAP2 and Tau-1. Data are mean axon lengths ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. The dotted grey line indicates the mean axon length of scrambled-shRNA-nucleofected neurons. (D,E) Hippocampal neurons nucleofected with scrambled shRNA or P2Y1 shRNA and treated with ADP (5 mM) from day 1 to day 3 in vitro. The graph in D shows the axon length in nucleofected neurons (GFP-positive) incubated in the presence or absence of ADP. (F–H) Hippocampal neurons nucleofected with scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA and treated with the P2Y1 antagonist (MRS-2179) or the P2Y13 antagonist (MRS-2211) from day 1 to day 3 in vitro. Scale bars: 50 mm. Note that in all cases P2Y1 expression and function is necessary for axon elongation. Data in G are the mean axon lengths ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. H shows the distribution of the axon length for all neurons from three independent experiments for each condition (n5300). (I) Hippocampal neurons that had been nucleofected with plasmids expressing GFP, P2Y1–GFP and P2Y13. After 3 DIV neurons were stained for MAP2 and Tau-1 to identify the axon. (J) P2Y1 or P2Y13 mean fluorescence intensity along the axon in control, scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA nucleofected neurons. (K) Graph of the mean axon lengths ± s.e.m. of neurons nucleofected with GFP, P2Y1–GFP or P2Y13 and GFP. Neurons were quantified in three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. Scale bars: 100 mm. Box-plot shows the distribution of axon lengths for all the neurons quantified in K.
Shrna, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+sirna/10__1161_slash_jaha__117__007457-36-6-24?v=OriGene
Average 96 stars, based on 1 article reviews
shrna - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

93
OriGene scramble sirna
Fig. 5. Effects of plasmin <t>on</t> <t>PDGF-D</t> induced inflammation. The plasmin antagonist (EACA) decreased ICH induced production of PDGF-D and p-PDGFRβ increases 24 h after ICH (A, #p b 0.05 vs sham. *p b 0.05 vs ICH. n = 6 mice per group), resulting in decreased microglia activation (B). Injection of the recombinant plasmin induced significant production of the PDGF-D in ipsilateral hemisphere (C, #p b 0.05 vs sham, @p b 0.05 vs contralateral. n = 6 mice per group). Increased MPO levels (D) were also observed after plasmin injection. While scrambled RNA has no effect, PDGF-D <t>siRNA</t> attenuated plasmin induced increase of MPO production (D, #p b 0.05 vs sham. αp b 0.05 vs Plasmin. n = 6 mice per group). Error bars represent mean ± standard error of the mean. Scale bar = 50um.
Scramble Sirna, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+sirna/pm27302678-66-7-14?v=OriGene
Average 93 stars, based on 1 article reviews
scramble sirna - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Addgene inc plasmid paav actin prom dsredscramble shrna
Fig. 5. Effects of plasmin <t>on</t> <t>PDGF-D</t> induced inflammation. The plasmin antagonist (EACA) decreased ICH induced production of PDGF-D and p-PDGFRβ increases 24 h after ICH (A, #p b 0.05 vs sham. *p b 0.05 vs ICH. n = 6 mice per group), resulting in decreased microglia activation (B). Injection of the recombinant plasmin induced significant production of the PDGF-D in ipsilateral hemisphere (C, #p b 0.05 vs sham, @p b 0.05 vs contralateral. n = 6 mice per group). Increased MPO levels (D) were also observed after plasmin injection. While scrambled RNA has no effect, PDGF-D <t>siRNA</t> attenuated plasmin induced increase of MPO production (D, #p b 0.05 vs sham. αp b 0.05 vs Plasmin. n = 6 mice per group). Error bars represent mean ± standard error of the mean. Scale bar = 50um.
Plasmid Paav Actin Prom Dsredscramble Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+sirna/pmc12541345__pnas%2E2422878122%2Esapp-67-30-34?v=Addgene+inc
Average 93 stars, based on 1 article reviews
plasmid paav actin prom dsredscramble shrna - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

91
OriGene scr shrna pgfp b rs
Fig. 5. Effects of plasmin <t>on</t> <t>PDGF-D</t> induced inflammation. The plasmin antagonist (EACA) decreased ICH induced production of PDGF-D and p-PDGFRβ increases 24 h after ICH (A, #p b 0.05 vs sham. *p b 0.05 vs ICH. n = 6 mice per group), resulting in decreased microglia activation (B). Injection of the recombinant plasmin induced significant production of the PDGF-D in ipsilateral hemisphere (C, #p b 0.05 vs sham, @p b 0.05 vs contralateral. n = 6 mice per group). Increased MPO levels (D) were also observed after plasmin injection. While scrambled RNA has no effect, PDGF-D <t>siRNA</t> attenuated plasmin induced increase of MPO production (D, #p b 0.05 vs sham. αp b 0.05 vs Plasmin. n = 6 mice per group). Error bars represent mean ± standard error of the mean. Scale bar = 50um.
Scr Shrna Pgfp B Rs, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+sirna/10__1158_slash_0008___5472__can___16___1666-32-23-24?v=OriGene
Average 91 stars, based on 1 article reviews
scr shrna pgfp b rs - by Bioz Stars, 2026-08
91/100 stars
  Buy from Supplier

90
Xeragon Inc fluorescence-labelled control, scrambled and human p140cap-specific sirnas (aagctgtgtctgttgaggctg)
Fig. 5. Effects of plasmin <t>on</t> <t>PDGF-D</t> induced inflammation. The plasmin antagonist (EACA) decreased ICH induced production of PDGF-D and p-PDGFRβ increases 24 h after ICH (A, #p b 0.05 vs sham. *p b 0.05 vs ICH. n = 6 mice per group), resulting in decreased microglia activation (B). Injection of the recombinant plasmin induced significant production of the PDGF-D in ipsilateral hemisphere (C, #p b 0.05 vs sham, @p b 0.05 vs contralateral. n = 6 mice per group). Increased MPO levels (D) were also observed after plasmin injection. While scrambled RNA has no effect, PDGF-D <t>siRNA</t> attenuated plasmin induced increase of MPO production (D, #p b 0.05 vs sham. αp b 0.05 vs Plasmin. n = 6 mice per group). Error bars represent mean ± standard error of the mean. Scale bar = 50um.
Fluorescence Labelled Control, Scrambled And Human P140cap Specific Sirnas (Aagctgtgtctgttgaggctg), supplied by Xeragon Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+sirna/pmc01894765-362-7-9?v=Xeragon+Inc
Average 90 stars, based on 1 article reviews
fluorescence-labelled control, scrambled and human p140cap-specific sirnas (aagctgtgtctgttgaggctg) - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma sirna for sp1 or ctcf and scramble sirna
Fig. 5. Effects of plasmin <t>on</t> <t>PDGF-D</t> induced inflammation. The plasmin antagonist (EACA) decreased ICH induced production of PDGF-D and p-PDGFRβ increases 24 h after ICH (A, #p b 0.05 vs sham. *p b 0.05 vs ICH. n = 6 mice per group), resulting in decreased microglia activation (B). Injection of the recombinant plasmin induced significant production of the PDGF-D in ipsilateral hemisphere (C, #p b 0.05 vs sham, @p b 0.05 vs contralateral. n = 6 mice per group). Increased MPO levels (D) were also observed after plasmin injection. While scrambled RNA has no effect, PDGF-D <t>siRNA</t> attenuated plasmin induced increase of MPO production (D, #p b 0.05 vs sham. αp b 0.05 vs Plasmin. n = 6 mice per group). Error bars represent mean ± standard error of the mean. Scale bar = 50um.
Sirna For Sp1 Or Ctcf And Scramble Sirna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+sirna/10__1161_slash_atvbaha__114__303899-151-7-14?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
sirna for sp1 or ctcf and scramble sirna - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Ribobio co scrambled negative control sirna
Fig. 5. Effects of plasmin <t>on</t> <t>PDGF-D</t> induced inflammation. The plasmin antagonist (EACA) decreased ICH induced production of PDGF-D and p-PDGFRβ increases 24 h after ICH (A, #p b 0.05 vs sham. *p b 0.05 vs ICH. n = 6 mice per group), resulting in decreased microglia activation (B). Injection of the recombinant plasmin induced significant production of the PDGF-D in ipsilateral hemisphere (C, #p b 0.05 vs sham, @p b 0.05 vs contralateral. n = 6 mice per group). Increased MPO levels (D) were also observed after plasmin injection. While scrambled RNA has no effect, PDGF-D <t>siRNA</t> attenuated plasmin induced increase of MPO production (D, #p b 0.05 vs sham. αp b 0.05 vs Plasmin. n = 6 mice per group). Error bars represent mean ± standard error of the mean. Scale bar = 50um.
Scrambled Negative Control Sirna, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+sirna/pm40643013-111-9-14?v=Ribobio+co
Average 90 stars, based on 1 article reviews
scrambled negative control sirna - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Ribobio co sirna of arg2, ho-1, creb1 and their matched scramble control
Fig. 5. Effects of plasmin <t>on</t> <t>PDGF-D</t> induced inflammation. The plasmin antagonist (EACA) decreased ICH induced production of PDGF-D and p-PDGFRβ increases 24 h after ICH (A, #p b 0.05 vs sham. *p b 0.05 vs ICH. n = 6 mice per group), resulting in decreased microglia activation (B). Injection of the recombinant plasmin induced significant production of the PDGF-D in ipsilateral hemisphere (C, #p b 0.05 vs sham, @p b 0.05 vs contralateral. n = 6 mice per group). Increased MPO levels (D) were also observed after plasmin injection. While scrambled RNA has no effect, PDGF-D <t>siRNA</t> attenuated plasmin induced increase of MPO production (D, #p b 0.05 vs sham. αp b 0.05 vs Plasmin. n = 6 mice per group). Error bars represent mean ± standard error of the mean. Scale bar = 50um.
Sirna Of Arg2, Ho 1, Creb1 And Their Matched Scramble Control, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+sirna/pm37856999-80-4-14?v=Ribobio+co
Average 90 stars, based on 1 article reviews
sirna of arg2, ho-1, creb1 and their matched scramble control - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Ribobio co scrambled or zap sirnas
Fig. 5. Effects of plasmin <t>on</t> <t>PDGF-D</t> induced inflammation. The plasmin antagonist (EACA) decreased ICH induced production of PDGF-D and p-PDGFRβ increases 24 h after ICH (A, #p b 0.05 vs sham. *p b 0.05 vs ICH. n = 6 mice per group), resulting in decreased microglia activation (B). Injection of the recombinant plasmin induced significant production of the PDGF-D in ipsilateral hemisphere (C, #p b 0.05 vs sham, @p b 0.05 vs contralateral. n = 6 mice per group). Increased MPO levels (D) were also observed after plasmin injection. While scrambled RNA has no effect, PDGF-D <t>siRNA</t> attenuated plasmin induced increase of MPO production (D, #p b 0.05 vs sham. αp b 0.05 vs Plasmin. n = 6 mice per group). Error bars represent mean ± standard error of the mean. Scale bar = 50um.
Scrambled Or Zap Sirnas, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+sirna/pmc04210284-297-8-10?v=Ribobio+co
Average 90 stars, based on 1 article reviews
scrambled or zap sirnas - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


Fig. 3. P2Y1 silencing impairs ADP-dependent axon elongation. (A) Hippocampal neurons were nucleofected with scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA. Neurons were fixed at 3 DIV and stained with an anti-a-tubulin antibody. Nucleofected neurons were identified by their GFP fluorescence. (B) HEK- 293T cells were co-transfected with GFP, P2Y1–GFP or P2Y13 plasmids, in combination with different P2Y1 or P2Y13 shRNAs. Data are means ± s.e.m. of three independent experiments. P2Y1–GFP and P2Y13 protein expression was normalized to a-tubulin expression levels; ***P,0.001. (C) Axon length of hippocampal neurons expressing scrambled shRNA, two different P2Y1 shRNAs or two different P2Y13 shRNAs was quantified after staining with antibodies against MAP2 and Tau-1. Data are mean axon lengths ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. The dotted grey line indicates the mean axon length of scrambled-shRNA-nucleofected neurons. (D,E) Hippocampal neurons nucleofected with scrambled shRNA or P2Y1 shRNA and treated with ADP (5 mM) from day 1 to day 3 in vitro. The graph in D shows the axon length in nucleofected neurons (GFP-positive) incubated in the presence or absence of ADP. (F–H) Hippocampal neurons nucleofected with scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA and treated with the P2Y1 antagonist (MRS-2179) or the P2Y13 antagonist (MRS-2211) from day 1 to day 3 in vitro. Scale bars: 50 mm. Note that in all cases P2Y1 expression and function is necessary for axon elongation. Data in G are the mean axon lengths ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. H shows the distribution of the axon length for all neurons from three independent experiments for each condition (n5300). (I) Hippocampal neurons that had been nucleofected with plasmids expressing GFP, P2Y1–GFP and P2Y13. After 3 DIV neurons were stained for MAP2 and Tau-1 to identify the axon. (J) P2Y1 or P2Y13 mean fluorescence intensity along the axon in control, scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA nucleofected neurons. (K) Graph of the mean axon lengths ± s.e.m. of neurons nucleofected with GFP, P2Y1–GFP or P2Y13 and GFP. Neurons were quantified in three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. Scale bars: 100 mm. Box-plot shows the distribution of axon lengths for all the neurons quantified in K.

Journal: Journal of cell science

Article Title: Adenylate cyclase 5 coordinates the action of ADP, P2Y1, P2Y13 and ATP-gated P2X7 receptors on axonal elongation.

doi: 10.1242/jcs.091736

Figure Lengend Snippet: Fig. 3. P2Y1 silencing impairs ADP-dependent axon elongation. (A) Hippocampal neurons were nucleofected with scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA. Neurons were fixed at 3 DIV and stained with an anti-a-tubulin antibody. Nucleofected neurons were identified by their GFP fluorescence. (B) HEK- 293T cells were co-transfected with GFP, P2Y1–GFP or P2Y13 plasmids, in combination with different P2Y1 or P2Y13 shRNAs. Data are means ± s.e.m. of three independent experiments. P2Y1–GFP and P2Y13 protein expression was normalized to a-tubulin expression levels; ***P,0.001. (C) Axon length of hippocampal neurons expressing scrambled shRNA, two different P2Y1 shRNAs or two different P2Y13 shRNAs was quantified after staining with antibodies against MAP2 and Tau-1. Data are mean axon lengths ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. The dotted grey line indicates the mean axon length of scrambled-shRNA-nucleofected neurons. (D,E) Hippocampal neurons nucleofected with scrambled shRNA or P2Y1 shRNA and treated with ADP (5 mM) from day 1 to day 3 in vitro. The graph in D shows the axon length in nucleofected neurons (GFP-positive) incubated in the presence or absence of ADP. (F–H) Hippocampal neurons nucleofected with scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA and treated with the P2Y1 antagonist (MRS-2179) or the P2Y13 antagonist (MRS-2211) from day 1 to day 3 in vitro. Scale bars: 50 mm. Note that in all cases P2Y1 expression and function is necessary for axon elongation. Data in G are the mean axon lengths ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. H shows the distribution of the axon length for all neurons from three independent experiments for each condition (n5300). (I) Hippocampal neurons that had been nucleofected with plasmids expressing GFP, P2Y1–GFP and P2Y13. After 3 DIV neurons were stained for MAP2 and Tau-1 to identify the axon. (J) P2Y1 or P2Y13 mean fluorescence intensity along the axon in control, scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA nucleofected neurons. (K) Graph of the mean axon lengths ± s.e.m. of neurons nucleofected with GFP, P2Y1–GFP or P2Y13 and GFP. Neurons were quantified in three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. Scale bars: 100 mm. Box-plot shows the distribution of axon lengths for all the neurons quantified in K.

Article Snippet: The adenylate cyclase 5 interference shRNAs (79 and 84) and control scrambled shRNA were purchased from Origene (TG506651).

Techniques: shRNA, Staining, Fluorescence, Transfection, Expressing, In Vitro, Incubation, Control

Fig. 5. Adenylate cyclase activity is necessary for ADP–P2Y1-dependent axon elongation. (A) Hippocampal neurons treated with the indicated compounds from day 1 to day 3 in vitro and stained for MAP2 and Tau-1. Scale bar: 100 mm. (B) Axon length in neurons treated with vehicle (black bars) or the indicated adenylate cyclase or cAMP regulators (white bars), in combination with agonists or antagonists of P2Y1 or P2Y13. Graphs represent the mean axon length ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001, **P,0.01; n.s., not significant. (C,E) Hippocampal neurons nucleofected with P2Y1 shRNA and stained at 3 DIV for Tau-1 or a-tubulin (red). Nucleofected neurons were identified by GFP fluorescence. Neurons were treated with the adenylate cyclase activator forskolin (5 mM) or a PDE4 inhibitor (20 nM). Note that both treatments reversed the negative effects of P2Y1 silencing or P2Y13 expression on axon elongation. The graphs in E show the axonal lengths ± s.e.m. from three independent experiments, analyzing 100 GFP positive neurons for each condition in each experiment; ***P,0.001. (D,F) Neurons nucleofected with P2X7 shRNA or P2X7– GFP expression plasmids and treated from day 1 to day 3 in vitro with the adenylate cyclase inhibitor (SQ-22536) or the adenylate cyclase activator forskolin, respectively. Note that adenylate cyclase activation or increased cAMP levels reversed the negative effect of P2X7–GFP expression on axon elongation. The graphs in F show the axon length ± s.e.m. from three independent experiments analyzing 100 neurons for each condition in each experiment; ***P,0.001. Scale bars: 100 mm.

Journal: Journal of cell science

Article Title: Adenylate cyclase 5 coordinates the action of ADP, P2Y1, P2Y13 and ATP-gated P2X7 receptors on axonal elongation.

doi: 10.1242/jcs.091736

Figure Lengend Snippet: Fig. 5. Adenylate cyclase activity is necessary for ADP–P2Y1-dependent axon elongation. (A) Hippocampal neurons treated with the indicated compounds from day 1 to day 3 in vitro and stained for MAP2 and Tau-1. Scale bar: 100 mm. (B) Axon length in neurons treated with vehicle (black bars) or the indicated adenylate cyclase or cAMP regulators (white bars), in combination with agonists or antagonists of P2Y1 or P2Y13. Graphs represent the mean axon length ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001, **P,0.01; n.s., not significant. (C,E) Hippocampal neurons nucleofected with P2Y1 shRNA and stained at 3 DIV for Tau-1 or a-tubulin (red). Nucleofected neurons were identified by GFP fluorescence. Neurons were treated with the adenylate cyclase activator forskolin (5 mM) or a PDE4 inhibitor (20 nM). Note that both treatments reversed the negative effects of P2Y1 silencing or P2Y13 expression on axon elongation. The graphs in E show the axonal lengths ± s.e.m. from three independent experiments, analyzing 100 GFP positive neurons for each condition in each experiment; ***P,0.001. (D,F) Neurons nucleofected with P2X7 shRNA or P2X7– GFP expression plasmids and treated from day 1 to day 3 in vitro with the adenylate cyclase inhibitor (SQ-22536) or the adenylate cyclase activator forskolin, respectively. Note that adenylate cyclase activation or increased cAMP levels reversed the negative effect of P2X7–GFP expression on axon elongation. The graphs in F show the axon length ± s.e.m. from three independent experiments analyzing 100 neurons for each condition in each experiment; ***P,0.001. Scale bars: 100 mm.

Article Snippet: The adenylate cyclase 5 interference shRNAs (79 and 84) and control scrambled shRNA were purchased from Origene (TG506651).

Techniques: Activity Assay, In Vitro, Staining, shRNA, Fluorescence, Expressing, Activation Assay

Fig. 6. Adenylate cyclase 5 activity is required for proper axonal elongation in response to ADP or P2X7 inhibition. (A,D) Hippocampal neurons cultured from day 1 to day 3 in vitro in the presence or absence of the PKCf inhibitor, PKCf pseudosubstrate (10 mM) in combination with ADP 5 mM, BBG 100 nM, MRS-2211 5 mM or forskolin 5 mM. Neurons were stained with anti-MAP2 and anti-Tau-1 antibodies. Graph in D shows the mean axonal lengths ± s.e.m. from three independent experiments. (B) Distribution of adenylate cyclase 5 in hippocampal neurons at 3 DIV. Arrow indicates the AC5 in the distal region of the axon. Right panels show the distal region of the axon stained for AC5 and F-actin. Scale bar: 100 mm. (C) Hippocampal neurons treated from day 1 to day 3 in vitro with ADP (5 mM) in the presence or absence of the adenylate cyclase 5 inhibitor NY80 (10 mM). Scale bar: 100 mm. (E) Mean axon lengths ± s.e.m. of 3 DIV neurons treated with vehicle (black bars) or NKY80 (white bars), in combination with ADP (5 mM), the P2Y13 antagonist MRS-2211, dbcAMP (2 mM), rPMT or PTX. Note that addition of dbcAMP impaired the inhibitory effect of NKY80 on axon growth; ***P,0.001. Data are from three independent experiments analyzing 100 neurons for each condition in each experiment. (F,H) Neurons nucleofected with GFP, P2Y1–GFP, scrambled shRNA, P2X7 shRNA or P2Y13 shRNA were cultured from day 1 to day 3 in vitro with vehicle or the adenylate cyclase 5 inhibitor, NKY80. (F) Representative images of these neurons. (H) Mean axonal lengths ± s.e.m. from three independent experiments analyzing 100 neurons for each condition in each experiment; ***P,0.001. (G,I) Neurons were nucleofected with scrambled shRNA or AC5 shRNA. (G) Representative images of 3 DIV neurons. (I) Mean axon length ± s.e.m. of neurons shown in G cultured in the presence of the indicated compounds at the concentrations shown previously. Scale bars: 100 mm.

Journal: Journal of cell science

Article Title: Adenylate cyclase 5 coordinates the action of ADP, P2Y1, P2Y13 and ATP-gated P2X7 receptors on axonal elongation.

doi: 10.1242/jcs.091736

Figure Lengend Snippet: Fig. 6. Adenylate cyclase 5 activity is required for proper axonal elongation in response to ADP or P2X7 inhibition. (A,D) Hippocampal neurons cultured from day 1 to day 3 in vitro in the presence or absence of the PKCf inhibitor, PKCf pseudosubstrate (10 mM) in combination with ADP 5 mM, BBG 100 nM, MRS-2211 5 mM or forskolin 5 mM. Neurons were stained with anti-MAP2 and anti-Tau-1 antibodies. Graph in D shows the mean axonal lengths ± s.e.m. from three independent experiments. (B) Distribution of adenylate cyclase 5 in hippocampal neurons at 3 DIV. Arrow indicates the AC5 in the distal region of the axon. Right panels show the distal region of the axon stained for AC5 and F-actin. Scale bar: 100 mm. (C) Hippocampal neurons treated from day 1 to day 3 in vitro with ADP (5 mM) in the presence or absence of the adenylate cyclase 5 inhibitor NY80 (10 mM). Scale bar: 100 mm. (E) Mean axon lengths ± s.e.m. of 3 DIV neurons treated with vehicle (black bars) or NKY80 (white bars), in combination with ADP (5 mM), the P2Y13 antagonist MRS-2211, dbcAMP (2 mM), rPMT or PTX. Note that addition of dbcAMP impaired the inhibitory effect of NKY80 on axon growth; ***P,0.001. Data are from three independent experiments analyzing 100 neurons for each condition in each experiment. (F,H) Neurons nucleofected with GFP, P2Y1–GFP, scrambled shRNA, P2X7 shRNA or P2Y13 shRNA were cultured from day 1 to day 3 in vitro with vehicle or the adenylate cyclase 5 inhibitor, NKY80. (F) Representative images of these neurons. (H) Mean axonal lengths ± s.e.m. from three independent experiments analyzing 100 neurons for each condition in each experiment; ***P,0.001. (G,I) Neurons were nucleofected with scrambled shRNA or AC5 shRNA. (G) Representative images of 3 DIV neurons. (I) Mean axon length ± s.e.m. of neurons shown in G cultured in the presence of the indicated compounds at the concentrations shown previously. Scale bars: 100 mm.

Article Snippet: The adenylate cyclase 5 interference shRNAs (79 and 84) and control scrambled shRNA were purchased from Origene (TG506651).

Techniques: Activity Assay, Inhibition, Cell Culture, In Vitro, Staining, shRNA

Fig. 5. Effects of plasmin on PDGF-D induced inflammation. The plasmin antagonist (EACA) decreased ICH induced production of PDGF-D and p-PDGFRβ increases 24 h after ICH (A, #p b 0.05 vs sham. *p b 0.05 vs ICH. n = 6 mice per group), resulting in decreased microglia activation (B). Injection of the recombinant plasmin induced significant production of the PDGF-D in ipsilateral hemisphere (C, #p b 0.05 vs sham, @p b 0.05 vs contralateral. n = 6 mice per group). Increased MPO levels (D) were also observed after plasmin injection. While scrambled RNA has no effect, PDGF-D siRNA attenuated plasmin induced increase of MPO production (D, #p b 0.05 vs sham. αp b 0.05 vs Plasmin. n = 6 mice per group). Error bars represent mean ± standard error of the mean. Scale bar = 50um.

Journal: Experimental neurology

Article Title: Role of PDGF-D and PDGFR-β in neuroinflammation in experimental ICH mice model.

doi: 10.1016/j.expneurol.2016.06.010

Figure Lengend Snippet: Fig. 5. Effects of plasmin on PDGF-D induced inflammation. The plasmin antagonist (EACA) decreased ICH induced production of PDGF-D and p-PDGFRβ increases 24 h after ICH (A, #p b 0.05 vs sham. *p b 0.05 vs ICH. n = 6 mice per group), resulting in decreased microglia activation (B). Injection of the recombinant plasmin induced significant production of the PDGF-D in ipsilateral hemisphere (C, #p b 0.05 vs sham, @p b 0.05 vs contralateral. n = 6 mice per group). Increased MPO levels (D) were also observed after plasmin injection. While scrambled RNA has no effect, PDGF-D siRNA attenuated plasmin induced increase of MPO production (D, #p b 0.05 vs sham. αp b 0.05 vs Plasmin. n = 6 mice per group). Error bars represent mean ± standard error of the mean. Scale bar = 50um.

Article Snippet: Experiment 5: The PDGF-D siRNAs mixture or scramble siRNA (100 pmol in 2 μl, OriGene) was administered intraventricularly 24 h before plasmin was injected into the right basal ganglia in naïve mice.

Techniques: Activation Assay, Injection, Recombinant